Another entry in the "is function arbitrary" series...
One of the most commonplace motifs in RNA molecules is the hairpin. The basic idea is this: the 'primary' structure of a strand of RNA is the sequence of bases, GCAU. But function doesn't depend on the primary sequence. That sequence has to be folded up into three dimensions - the 'tertiary' structure. In between primary and tertiary, we have the secondary structure, which captures most of the bonding between nucleotides in a flat, 2D picture.
An RNA hairpin's primary structure is like a palindrome, the beginning and end are mirrors of each other. For example:
GUGCCACGAUUCAACGUGGCAC
Looks like:
(Credit Wikipedia, article 'Stem-Loop')
It just isn't that hard for these things to form by chance. An example such as the above, with an 8 base pair stem, has a 1 in 64,000 chance of forming in a random chain. That might not sound like a lot to us humans, but to molecules where gazillions can be held in a drop of water, a lot hairpins can form! 1 in 64K is way way lower than William Dembski's Universal Probability Bound of 1 in 10^150, so even he would agree that no "Intelligent Designer" is necessary.
So if 1 in 64K of short (11 base pair) primary sequences forms a hairpin secondary structure, how many of those show stability and biological function as a tertiary (3D) structure? A good question. "Function" can be based on the choice of the base pair at the bottom of the stem, the stem pairs, and the top. But it is clear that even small, simple molecules such as these can have significant function, as shown by the existence of ribozymes (enzymes made of RNA) such as the Hairpin or Hammerhead ribozyme.
Further, really important molecules such as transfer RNA are simply 4 hairpins stuck together like Lego blocks. This structure can be broken down into the "top half", consisting of two of the hairpins, and the "bottom half", the other two. These halves could have evolved independently and then acquired new functionality when they stuck together.
A key message of ID and pure creationist propaganda is that the system of replication used in cells today is too complex to have arisen without guidance by a Creator. Looking at the reality of RNA hairpins, we can see that this is not true. A key piece of our current replication machinery is cobbled together from smaller parts that could easily have formed by chance, and then been retained for their function.
Wednesday, April 25, 2012
Subscribe to:
Post Comments (Atom)

No comments:
Post a Comment