Wednesday, May 23, 2012

Graceland

Blanka and I drove down to Memphis last week to spend some time with my Dad and his wife Doris. We had a great time. It was the first time I had been in Memphis since childhood.
We visited two places on our own, Graceland, and the National Civil Rights Museum.

Graceland, as most of the planet knows, is the home of the second best musician to graduate from Humes High School. (My father being number one, of course.) There was plenty of over the top Elvis worship on display, but it was enjoyable and a good introduction to the music and times Elvis shaped.

A different take on the same period was the NCRM. The museum preserves the facade of the Lorraine Motel, the site of Dr. Martin Luther King Jr.'s assassination. The museum exhibits wind back and forth, and rise by carefully placed ramps until suddenly you are there, looking out of the window of room 307, right next to Dr. King's 306.

The museum is a powerful testimony to the civil rights struggle. One of the best parts, in my view, was the short film, "The Witness". Narrated for the most part by Rev. Billy Kyles, who was standing just a few feet from Dr. King when he was killed, the film gives the context for the events that brought Dr. King to Memphis.

The film is extremely effective and emotional. I highly recommend it. I purchased a copy in the museum store, and it has been uploaded to vimeo (not sure of the legality of that, though).

Friday, May 4, 2012

Superconductivity and Intelligent Design

I was reading a recent article on the very cool topic of topological insulators when it reminded me of an interesting period of time.

Superconductivity, the phenomenon of complete absence of electrical resistance, was first observed by Heike Kamerlingh Onnes in 1911. The observation was readily repeatable, and Onnes won the 1913 Nobel Prize in Physics for its discovery. However, for nearly 50 years there was no theoretical explanation that really satisfied the physics community. But during the 1950s the BCS theory of Cooper pairs of electrons acting as phonons was developed that described a mechanism for superconductivity.

Never, to my knowledge, did the physics community assume intelligent design was the answer for why superconductivity existed. There was not naturalistic explanation for 50 years, yet they never lobbied for a supernatural explanation as the 'default' or inference to the 'best' explanation. I wonder why that is?

Going Green

We just purchased a beautiful floor lamp at the Zen Shop in Riverside Square Mall.


The vertical poles are dark stained bamboo, and the panels are real cocoa (chocolate tree) leaves. It looks fantastic either lit or unlit. Unlit, the panels are an emerald green, darker than the image. Thank you Michelle for stocking this!

Blanka wanted something to celebrate returning from her Soul Coaching seminar in California, and this was it!

Wednesday, April 25, 2012

Hairpin RNA

Another entry in the "is function arbitrary" series...

One of the most commonplace motifs in RNA molecules is the hairpin. The basic idea is this: the 'primary' structure of a strand of RNA is the sequence of bases, GCAU. But function doesn't depend on the primary sequence. That sequence has to be folded up into three dimensions - the 'tertiary' structure. In between primary and tertiary, we have the secondary structure, which captures most of the bonding between nucleotides in a flat, 2D picture.

An RNA hairpin's primary structure is like a palindrome, the beginning and end are mirrors of each other. For example:

GUGCCACGAUUCAACGUGGCAC

Looks like:
(Credit Wikipedia, article 'Stem-Loop')

It just isn't that hard for these things to form by chance. An example such as the above, with an 8 base pair stem, has a 1 in 64,000 chance of forming in a random chain. That might not sound like a lot to us humans, but to molecules where gazillions can be held in a drop of water, a lot hairpins can form! 1 in 64K is way way lower than William Dembski's Universal Probability Bound of 1 in 10^150, so even he would agree that no "Intelligent Designer" is necessary.

So if 1 in 64K of short (11 base pair) primary sequences forms a hairpin secondary structure, how many of those show stability and biological function as a tertiary (3D) structure? A good question. "Function" can be based on the choice of the base pair at the bottom of the stem, the stem pairs, and the top. But it is clear that even small, simple molecules such as these can have significant function, as shown by the existence of ribozymes (enzymes made of RNA) such as the Hairpin or Hammerhead ribozyme.

Further, really important molecules such as transfer RNA are simply 4 hairpins stuck together like Lego blocks. This structure can be broken down into the "top half", consisting of two of the hairpins, and the "bottom half", the other two. These halves could have evolved independently and then acquired new functionality when they stuck together.

A key message of ID and pure creationist propaganda is that the system of replication used in cells today is too complex to have arisen without guidance by a Creator. Looking at the reality of RNA hairpins, we can see that this is not true. A key piece of our current replication machinery is cobbled together from smaller parts that could easily have formed by chance, and then been retained for their function.

RNA vs. Jenga!

I recently spent some time talking about binding affinities in molecules such as DNA, RNA, and proteins. I said previously that there wasn't any differential binding affinity from one base pair to the next.

That turns out not to be the case. (aka FAIL) There _are_ base stacking interactions that can stabilize DNA and RNA molecules. These means that some sequences will be more likely than others in the real world.

The situation can be explained with an analogy to human language. This is good, because Polanyi worshipers love this analogy. In English, Q is followed by U consistently. That is a complete affinity. We can also talk about an affinity between two classes of letters, those representing consonant sounds and those representing vowel sounds. A string of letters is more likely if it contains alternations between these two classes.

Why is that? Well, in written English you'd be wrong to imagine that the choice of letter order was entirely arbitrary, it obviously isn't. (If it was, we wouldn't be able to compress English text very well, which is obviously not the case.) Written English derives from spoken English, and it is a lot easier to transition from one consonant to another through a vowel sound rather than directly. If you disagree, try the Czech phrase "StrĨ prst skrz krk" which translates roughly as "stick a finger in your throat".

From here, we can see that Polanyi's analogy was a FAIL to begin with, since the thing he wanted to analogize to, human language, does show constraints based on physical properties of the world and is not an arbitrary symbol system.

And Jenga!? Obviously, the choices you make in this block stacking game are not arbitrary, either. Every player knows that a stack built of "middle" bricks is going to be very unstable.

Friday, April 13, 2012

No error bars, no science

There is a meme circulating in the skeptics of global warming blogosphere - "no error bars, no science" which is meant as a criticism of papers they disagree with. A laudable concern in general, but what is good for the goose is good for the gander. 

Apply the same idea to ID, friends. What is the error bar on "Goddidit"? If ID would like to be considered a scientific topic, what error bars will Dembski, et al. attach to their work?

Tuesday, April 10, 2012

Moshe Averick Helps Meyer Hide the Afikoman of Understanding


Signature in the Cell, Stephen Meyer's gift that keeps on giving. Published in 2009, this book stirred up some controversy at the time over its review of Origin Of Life (OOL) theories and crowning of ID as the "best explanation".

Recently, the book was reviewed by British geneticist Richard Saunders on his blog, Wonderful Life. This review attracted the attention of the Discovery Institute and one of the DI's pilot fish, Moshe Averick. Averick wrote a scolding rejoinder to Saunders, earning him a pat on the head from David Klinghoffer over on Evolution News and Views.

(An aside. Averick deserves some respect, not for the validity of his opinions or his choice of culture war bedmates, but for having the guts to write in a forum that accepts comments. Most of the DI propaganda machine operates in the criticism free zone of their own web sites, no comments allowed. The same tip of the hat goes to Cornelius Hunter, the Baghdad Bob of anti-Darwinian creationists. Hunter's agit-prop is completely disengaged from the stated moral code of his religion, but he does allow comments to his blog!)

I'm not going to try to fisk Averick's piece, it doesn't deserve that much attention. I am going to focus on the issue of Meyer's discussion of differential binding affinities, since it was one of the points about Saunder's review that Averick jumped on.

Wow, "differential binding affinities"... I can hear your eyes glazing over already. Half my readership just left to check their Facebook pages, and there was only two of you in the first place!

Yes friend, "differential binding affinities" is actually one of those important places in Signature in the Cell where Meyer connects his philosophy to real world science, showing the roots of the Intelligent Design movement.

Stepping back for a moment, one of the big ID arguments is that everything has to be explained by one of three drivers, chance, necessity, or Design. If we can eliminate chance and necessity, we are forced to choose Design as the best explanation.

So what are differential binding affinities? We know that DNA uses a four letter alphabet, ACGT. In a real DNA molecule, A and T pair up, as do C and G. These pairs are on the inside of the famous double helix shape. They are the rungs of the twisting ladder. The outside of the helix, where each pair is connected to the next pair, is made of phosphate molecules.

If I told you that one 'rung' of the helix was A-T, could you predict the next rung? Not really. There are four possibilities (A-T, T-A, C-G, and G-C) and they are all equally probable. That is the opposite of a differential affinity. In a differential affinity, A-T might be followed 50% the time by T-A, and never by G-C.

Meyer connects this idea to two different strands of thought. One is the idea that either the proteins or DNA sequences of life exist by necessity - because there is no other way to make the pieces fit together. Meyer attributes this idea to Dean Kenyon as an early (1980s) OOL explanation. My research can't confirm whether this idea actually had any followers. 

I admit that I am a bit suspicious since Kenyon, now a creationist, works with Stephen Meyer at the Discovery Institute. Bringing in Kenyon's work gives Meyer a strawman to knock down and an opportunity to play the sympathy card for Kenyon, who faced some strong criticism for mixing in creationism in his evolution courses.

The other connection is with the philosophy of Michael Polanyi. Polanyi was a well respected chemist and philosopher of science, but apparently had a thing about evolution. He wrote an essay, "Life's Irreducible Structure", that is very influential to the ID movement. It is to this essay that Meyer links the binding affinities issue, since to him it affirms the position of Polanyi that information is not reducible to structure, the "physico-chemical" laws of the universe.

This is (finally!) the important point of this section of Meyer's book. It is important to Meyer, and that is why it gets the "revelation from on high" treatment that Saunders objects to in his review, mentioned above.

Sorry, your afikoman is in another castle!

Since Averick is not shy about his rabbinic degree, I'll use a timely Jewish analogy. During the Passover seder, the leader hides the afikoman, a piece of matzah that will be used to complete the rituals later in the evening. Meyer (not Jewish, BTW) is also hiding something, and Averick is only too happy to help him do it. What is that something?

Meyer's book is about the origin of the genetic code. That is the "signature in the cell". The genetic code maps triplets of RNA nucleotides (AGC, for example) to the 20 or so amino acids that are used to build proteins. But Meyer is hiding something about nucleotide triplets and amino acids, and if you guessed "differential binding affinities" you win!

Here's the basic idea. Make some long repeating strands of RNA, such as ACTACTACT... . Now stir in different amino acids. In water, all the RNA and amino acid molecules will be in constant motion, bumping into each other in various ways. Sometimes they might stick briefly to each other before the water molecules push them apart. That length of time is their biding affinity and it is not the same for all combinations. Some combinations of triplet and amino acid are much more likely to stick together than others.

What does this mean? Say we had a little OOL scenario, warm pond, all the amino acids floating around and some short random RNA sequences as well. One of those RNAs is AUGGCC, for example. The AUG will prefer to stick to the amino acid Methionone, while the GCC will prefer to stick to Alanine. At some point, both a Methionone and an Alanine are sticking to this little RNA long enough for them to link together spontaneously. Now instead of two amino acids we have one small protein. 

The point here is that the differential stickiness of RNA and amino acids did not have to be "Designed". It is inherent in the physics and chemistry of the world. Polanyi was wrong. The genetic code was not "Designed", it flows naturally from these differential binding affinities.

What I've sketched out in the preceding paragraphs is called the "stereochemical hypothesis", and is an active research topic for OOL scientists such as Michael Yarus. (It is active because more evidence keeps accumulating that it is correct.) Meyer claims to be giving a thorough survey of all OOL work in his book, as a matter of fact his argument _requires_ him to survey all possible options and find them inadequate before he can conclude that Design is the best explanation. But just like the seder leader hiding the afikoman, Meyer has hidden any discussion of the stereochemical hypothesis (and most of the rest of the modern research on the RNA World) from view in his book.

Averick, the cheerleader and pilot fish, is only too happy to help do the hiding. He doesn't know the stereochemical hypothesis from a hole in the wall, but if Meyer is going to pound on about no differential binding affinities in DNA, Averick is there pounding also.