Showing posts with label beginnings. Show all posts
Showing posts with label beginnings. Show all posts
Wednesday, October 17, 2012
WAMP step 1: the Apache httpd server
Our goal in this process is to set up WordPress to serve the test content of a website and blog. Therefore the very first thing we are going to need is a web server.
I should say at the beginning that you don't need a web server to test basic web pages, you can write HTML files with any text editor, and then point your web browser at the file. You can teach yourself a lot of HTML and client-side JavaScript programming in this way. I think it is better to learn the fundamentals of how web pages work by typing it out for yourself instead of starting with a web development environment - you really understand what is going on.
Web servers deliver content to browsers. This content (web pages, music, images, etc.) is either a file on your machine's hard drive, or data stored in a database (on the hard drive). If it is data from the database, then a program (a script) must be run first to turn it into a document that is served out by the web server.
So even before we set up our Apache web server, we need to set up some space on our hard drive where this content will live. Importantly, we want this space to be independent of the Apache server file structure, so that we can back it up separately, and update Apache if necessary without moving our content. We could even change web servers entirely and our content would still be in the same place.
I should say at the beginning that you don't need a web server to test basic web pages, you can write HTML files with any text editor, and then point your web browser at the file. You can teach yourself a lot of HTML and client-side JavaScript programming in this way. I think it is better to learn the fundamentals of how web pages work by typing it out for yourself instead of starting with a web development environment - you really understand what is going on.
Web servers deliver content to browsers. This content (web pages, music, images, etc.) is either a file on your machine's hard drive, or data stored in a database (on the hard drive). If it is data from the database, then a program (a script) must be run first to turn it into a document that is served out by the web server.
So even before we set up our Apache web server, we need to set up some space on our hard drive where this content will live. Importantly, we want this space to be independent of the Apache server file structure, so that we can back it up separately, and update Apache if necessary without moving our content. We could even change web servers entirely and our content would still be in the same place.
Wednesday, April 25, 2012
Hairpin RNA
Another entry in the "is function arbitrary" series...
One of the most commonplace motifs in RNA molecules is the hairpin. The basic idea is this: the 'primary' structure of a strand of RNA is the sequence of bases, GCAU. But function doesn't depend on the primary sequence. That sequence has to be folded up into three dimensions - the 'tertiary' structure. In between primary and tertiary, we have the secondary structure, which captures most of the bonding between nucleotides in a flat, 2D picture.
An RNA hairpin's primary structure is like a palindrome, the beginning and end are mirrors of each other. For example:
GUGCCACGAUUCAACGUGGCAC
Looks like:
(Credit Wikipedia, article 'Stem-Loop')
It just isn't that hard for these things to form by chance. An example such as the above, with an 8 base pair stem, has a 1 in 64,000 chance of forming in a random chain. That might not sound like a lot to us humans, but to molecules where gazillions can be held in a drop of water, a lot hairpins can form! 1 in 64K is way way lower than William Dembski's Universal Probability Bound of 1 in 10^150, so even he would agree that no "Intelligent Designer" is necessary.
So if 1 in 64K of short (11 base pair) primary sequences forms a hairpin secondary structure, how many of those show stability and biological function as a tertiary (3D) structure? A good question. "Function" can be based on the choice of the base pair at the bottom of the stem, the stem pairs, and the top. But it is clear that even small, simple molecules such as these can have significant function, as shown by the existence of ribozymes (enzymes made of RNA) such as the Hairpin or Hammerhead ribozyme.
Further, really important molecules such as transfer RNA are simply 4 hairpins stuck together like Lego blocks. This structure can be broken down into the "top half", consisting of two of the hairpins, and the "bottom half", the other two. These halves could have evolved independently and then acquired new functionality when they stuck together.
A key message of ID and pure creationist propaganda is that the system of replication used in cells today is too complex to have arisen without guidance by a Creator. Looking at the reality of RNA hairpins, we can see that this is not true. A key piece of our current replication machinery is cobbled together from smaller parts that could easily have formed by chance, and then been retained for their function.
One of the most commonplace motifs in RNA molecules is the hairpin. The basic idea is this: the 'primary' structure of a strand of RNA is the sequence of bases, GCAU. But function doesn't depend on the primary sequence. That sequence has to be folded up into three dimensions - the 'tertiary' structure. In between primary and tertiary, we have the secondary structure, which captures most of the bonding between nucleotides in a flat, 2D picture.
An RNA hairpin's primary structure is like a palindrome, the beginning and end are mirrors of each other. For example:
GUGCCACGAUUCAACGUGGCAC
Looks like:
(Credit Wikipedia, article 'Stem-Loop')
It just isn't that hard for these things to form by chance. An example such as the above, with an 8 base pair stem, has a 1 in 64,000 chance of forming in a random chain. That might not sound like a lot to us humans, but to molecules where gazillions can be held in a drop of water, a lot hairpins can form! 1 in 64K is way way lower than William Dembski's Universal Probability Bound of 1 in 10^150, so even he would agree that no "Intelligent Designer" is necessary.
So if 1 in 64K of short (11 base pair) primary sequences forms a hairpin secondary structure, how many of those show stability and biological function as a tertiary (3D) structure? A good question. "Function" can be based on the choice of the base pair at the bottom of the stem, the stem pairs, and the top. But it is clear that even small, simple molecules such as these can have significant function, as shown by the existence of ribozymes (enzymes made of RNA) such as the Hairpin or Hammerhead ribozyme.
Further, really important molecules such as transfer RNA are simply 4 hairpins stuck together like Lego blocks. This structure can be broken down into the "top half", consisting of two of the hairpins, and the "bottom half", the other two. These halves could have evolved independently and then acquired new functionality when they stuck together.
A key message of ID and pure creationist propaganda is that the system of replication used in cells today is too complex to have arisen without guidance by a Creator. Looking at the reality of RNA hairpins, we can see that this is not true. A key piece of our current replication machinery is cobbled together from smaller parts that could easily have formed by chance, and then been retained for their function.
Monday, June 21, 2010
What was the early earth really like?
I've been trying to collect some facts/factoids about what the environment of the Archaean Earth might have been like, in order to organize some of my thinking about origin-of-life scenarios.
Sun:
Earth:
Moon:
Put some of these together, and you get a recipe for incredible weather. We often think of the ancient Earth as tropical volcanic islands being lapped gently by tides that swish warm and shallow waters of a lagoon containing a dilute organic soup.
Think again. Think howling winds blowing endlessly around the world, as they do between Antarctica and the southern continents. Think waves pushed by that wind and tides the size of the World Trade Center towers, rushing over flat landscapes to crash like tsunamis and run inland for miles, or entirely across the landscape to the next shoreline. Every 3 hours.
Think of the hurricanes. Clouds and rain nucleate around dust and organic chemicals floating in the sky. Not much of either would be available, so those heaving oceans just evaporate, and the amount of water in the atmosphere just keeps building up. And up. And up until it supersaturates. And then finally the rain starts to fall in huge fat drops. The storm grows, the quickly whirling planet triggers a spiral, an eye.
But there is no landfall to dissipate this hurricane. There is just the wind howling around the planet, and isolated islands being drowned by the tides. The hurricane could spin like Jupiter's Great Red Spot, around the world and then back over the same ocean that spawned it.
What are some of the Origin Of Life (OOL) implications?
High UV levels striking the ocean surface, where water and CO2 are present, can rapidly build many organic molecules. Some people fear that the UV would break big molecules apart faster than they could form. Luckily, that is not true. Long chain molecules, such as RNA, can 'quench' the high energy photon before it heats up the entire molecule, or breaks a single bond. The heat drains away into the ocean. So the high UV works in life's favor to build up lots of the chemicals of life.
Those winds? It turns out that the top layer of the ocean, a skin only a few millimeters thick, has its own dynamics. Evaporation raises the concentration of other chemicals just below the surface. And the wind whips the surface into masses of bubbles - spindrift. These bubbles trap chemicals together for long periods.
The tides? The endless pounding that landforms received was insurance that all kinds of useful chemicals were ground up and dissolved in the ocean, as rapidly as the volcanoes brought them to the surface.
It is also true that the endless cycling of tides and drying out is a natural form of what we call PCR - a way to duplicate organic molecules
No continents also meant that there was a much larger network of undersea cracks in the crust, where seawater and lava could meet. Today these conditions exist in fewer places, creating the 'black smokers' and 'lost cities' that support life without light. They would have been far more common in the ancient past.
Bottom line - as truly alien as our planet must have been three and a half billion years ago, it was still a setting in which life blossomed almost as soon as it was able. Some of the most important reasons are all based in the existence of the Moon as the large close companion of the Earth. Life may come up out of the depths, or at the surface, but the Moon donated the rocks and created the stirring motion of our oceans.
Sun:
- 70% weaker in total(?) radiation - weaker at least in the visible by that much.
- higher activity in UV range
- spinning faster - like the Earth and the Moon, before they all traded rotation for distance.
- larger magnetic field - from the faster spin.
- bigger solar gamma and x-ray bursts - from the larger magnetic field.
Earth:
- 6-12 hour rotation period - if you back up from current conditions of the Earth-Moon system, this is what you get for the time right after the Moon reformed after the impact of some Mars-size planetoid with the proto-Earth.
- 3x current heat flux from the interior due to more radioactives.
- thick atmosphere of CO2 (like Venus today) - there is a huge amount of CO2 buried today as rock formed by life.
- no oxygen, so no ozone to stop UV from reaching the surface - an incredible 10^30 more! That is a mind boggling amount of radiation, which the ozone layer currently keeps at bay.
- tides are 1000 times higher! (if moon is 10x closer)
- winds are very strong, east-west bands - due to rapid rotation.
- no large continents
- low levels of cloud cover -no nucleating particles.
- high level of infall of cometary organic material - inner solar system still full of debris
Moon:
- much closer (10x closer?) - that is inside Earth's geosynchronous orbit. We have satellites that would have been further away!
- spinning itself - not yet tidally locked
- covering a huge piece of the sky - because of being so close
- collisions that make moons such as ours are rare but not completely unlikely - they might happen in 5-10% of solar systems with rocky planets
- 30 (out of 300) gas giant exoplanets discovered so far orbit in their star's 'habzone' - even if the planet is too big for life as we know it, it could have life bearing moons
Put some of these together, and you get a recipe for incredible weather. We often think of the ancient Earth as tropical volcanic islands being lapped gently by tides that swish warm and shallow waters of a lagoon containing a dilute organic soup.
Think again. Think howling winds blowing endlessly around the world, as they do between Antarctica and the southern continents. Think waves pushed by that wind and tides the size of the World Trade Center towers, rushing over flat landscapes to crash like tsunamis and run inland for miles, or entirely across the landscape to the next shoreline. Every 3 hours.
Think of the hurricanes. Clouds and rain nucleate around dust and organic chemicals floating in the sky. Not much of either would be available, so those heaving oceans just evaporate, and the amount of water in the atmosphere just keeps building up. And up. And up until it supersaturates. And then finally the rain starts to fall in huge fat drops. The storm grows, the quickly whirling planet triggers a spiral, an eye.
But there is no landfall to dissipate this hurricane. There is just the wind howling around the planet, and isolated islands being drowned by the tides. The hurricane could spin like Jupiter's Great Red Spot, around the world and then back over the same ocean that spawned it.
What are some of the Origin Of Life (OOL) implications?
High UV levels striking the ocean surface, where water and CO2 are present, can rapidly build many organic molecules. Some people fear that the UV would break big molecules apart faster than they could form. Luckily, that is not true. Long chain molecules, such as RNA, can 'quench' the high energy photon before it heats up the entire molecule, or breaks a single bond. The heat drains away into the ocean. So the high UV works in life's favor to build up lots of the chemicals of life.
Those winds? It turns out that the top layer of the ocean, a skin only a few millimeters thick, has its own dynamics. Evaporation raises the concentration of other chemicals just below the surface. And the wind whips the surface into masses of bubbles - spindrift. These bubbles trap chemicals together for long periods.
The tides? The endless pounding that landforms received was insurance that all kinds of useful chemicals were ground up and dissolved in the ocean, as rapidly as the volcanoes brought them to the surface.
It is also true that the endless cycling of tides and drying out is a natural form of what we call PCR - a way to duplicate organic molecules
No continents also meant that there was a much larger network of undersea cracks in the crust, where seawater and lava could meet. Today these conditions exist in fewer places, creating the 'black smokers' and 'lost cities' that support life without light. They would have been far more common in the ancient past.
Bottom line - as truly alien as our planet must have been three and a half billion years ago, it was still a setting in which life blossomed almost as soon as it was able. Some of the most important reasons are all based in the existence of the Moon as the large close companion of the Earth. Life may come up out of the depths, or at the surface, but the Moon donated the rocks and created the stirring motion of our oceans.
Saturday, January 9, 2010
Review: Sherlock Holmes
I saw Sherlock Holmes last night with my son.
Likes:
Title design
Set dressing
Irene Adler
Humor
Dislikes:
That same washed out color palette you've seen in other recent films.
For those who enjoyed Robert Downey Jr. in Ironman, Sherlock Holmes (the film) has a bit of steampunk Tony Stark to the character Sherlock Holmes. Jude Law plays Dr Watson very well in my view. Rachel McAdams plays Irene Adler, the moral, comic, romantic, and intellectual foil (and equal) to Downey's Holmes.
One of the joys of detective fiction for a reader is to see if they can solve the mystery before the main character. This is difficult in film detective stories, but this film does honor the trope by at least letting you see the clues, even if they whiz by too fast to process until the requisite flashback at the end.
Holmes and Watson as the bickering odd couple got old fast, though it was better than the fawning hero worship versions of Watson in other films.
The least likable parts of the film are the fight scenes. Holmes does have a reputation 'in canon' as a boxer and martial artist, so I am not objecting that they are out of character. Rather, they are filmed in gratuitous slo-mo intercut with sped up footage on some very cluttered sets. The result is some very muddy views of the action - who is hitting whom how.
Recommended - a well made 'reboot' (though not 'origins') genre film. Strong detective, minor steampunk notes, and no bitter aftertaste.
Likes:
Title design
Set dressing
Irene Adler
Humor
Dislikes:
That same washed out color palette you've seen in other recent films.
For those who enjoyed Robert Downey Jr. in Ironman, Sherlock Holmes (the film) has a bit of steampunk Tony Stark to the character Sherlock Holmes. Jude Law plays Dr Watson very well in my view. Rachel McAdams plays Irene Adler, the moral, comic, romantic, and intellectual foil (and equal) to Downey's Holmes.
One of the joys of detective fiction for a reader is to see if they can solve the mystery before the main character. This is difficult in film detective stories, but this film does honor the trope by at least letting you see the clues, even if they whiz by too fast to process until the requisite flashback at the end.
Holmes and Watson as the bickering odd couple got old fast, though it was better than the fawning hero worship versions of Watson in other films.
The least likable parts of the film are the fight scenes. Holmes does have a reputation 'in canon' as a boxer and martial artist, so I am not objecting that they are out of character. Rather, they are filmed in gratuitous slo-mo intercut with sped up footage on some very cluttered sets. The result is some very muddy views of the action - who is hitting whom how.
Recommended - a well made 'reboot' (though not 'origins') genre film. Strong detective, minor steampunk notes, and no bitter aftertaste.
Saturday, August 15, 2009
It's a HYBRID!!!
How time flies. Just yesterday, it seems, I was seeing my son Nathan for the first time, a pudgy five month old straight off the plane from South Korea. Now he's starting college in September.
Since he has to drive to school, I'm giving him my old car, an Altima with over 100,000 miles on it. Still works fine, but definitely old. So I got a new car for myself.
Normally, I would never buy a new car, I'd buy a newer used car. I hate the car buying/selling experience. My father taught me to buy from a fleet owner - the price is fixed, the car is well maintained. No hassle. That's how I got my old car.
But I wanted to reduce my carbon footprint, and after reading The Weathermakers I was convinced that the best way to do that was to make my next car a hybrid. So I bought one.
Softening the blow is that the Altima hybrid still qualifies for a tax credit. It is not sold everywhere, only six states in the US. Since I wasn't trading in, I couldn't get the cash for clunkers incentive also, but that was ok. (I know, a big part of the carbon reduction is supposed to be taking the old car off the road. Ooops.)
Anyway, after 3 weeks of new car ownership, I have to say that I love this car. The hybrid engine is very powerful on acceleration, the regenerative system contributes to powerful braking also. My average MPG is now up to 32. The instantaneous MPG feedback is helping me to learn to drive "greener".
The nice folks at Hackensack Nissan sold me a great car. Thank you!
Since he has to drive to school, I'm giving him my old car, an Altima with over 100,000 miles on it. Still works fine, but definitely old. So I got a new car for myself.
Normally, I would never buy a new car, I'd buy a newer used car. I hate the car buying/selling experience. My father taught me to buy from a fleet owner - the price is fixed, the car is well maintained. No hassle. That's how I got my old car.
But I wanted to reduce my carbon footprint, and after reading The Weathermakers I was convinced that the best way to do that was to make my next car a hybrid. So I bought one.
Softening the blow is that the Altima hybrid still qualifies for a tax credit. It is not sold everywhere, only six states in the US. Since I wasn't trading in, I couldn't get the cash for clunkers incentive also, but that was ok. (I know, a big part of the carbon reduction is supposed to be taking the old car off the road. Ooops.)
Anyway, after 3 weeks of new car ownership, I have to say that I love this car. The hybrid engine is very powerful on acceleration, the regenerative system contributes to powerful braking also. My average MPG is now up to 32. The instantaneous MPG feedback is helping me to learn to drive "greener".
The nice folks at Hackensack Nissan sold me a great car. Thank you!
Monday, May 11, 2009
Star Trek movie review
Yes, I was going to go eventually, but my son Daniel deserves the credit for pestering me to go this weekend to an IMAX showing of Star Trek. It was an 11 PM show, so it was almost the full geek experience possible.
I agree with a lot of other people, this is definitely worth your popcorn money, and IMAX is the way to go.
Likes-
I agree with a lot of other people, this is definitely worth your popcorn money, and IMAX is the way to go.
Likes-
- mix of old and new
- plenty of homage to TOS (the original series, for the non-Trekker), to the level of some audio cues
- humor
- Zoe Saldana's way retro outfit
- Zoe in general
- Zoe in specific
- Zoe Zoe in a bar
- Zoe Zoe in a car
- Zoe and Green Eggs and Ham (or whatever that girl's name was)
Dislikes
- way too much lens flare
- naval tactics of the WWI era
- Romulan mining vessels that look like goose roadkill
- destroy two planets (Vulcan and Romulus) and stick us in an alternate universe
- Scotty's mascot - should get an award for Establishing Annoying Alien Sidekick Persona In the Fewest Scenes
- all the Star Wars homage, i.e. Ice Planet, there's always a bigger fish, Kirk as Han Solo punching bag, planet destroying ship, older Spock as Obi Wan
I don't think the big open sets made sense as the machinery spaces of the Enterprise. No one would build a military spaceship that way.
By far, the best line in the film is "Your father was captain of a starship for twelve minutes, and saved 800 lives."
I like the set up of the Kirk/Spock/Uhura triangle. As a reboot, I would have been happier if the creative team had just established that much in this film. The film crowds in all of the basic characters, and is a bit too hyperactive in doing so. In comparison, the Bond reboot is two films old and we still haven't met Moneypenny and Q.
Bottom line: Go!
Saturday, May 2, 2009
Wolverine movie review
I saw the new X-Men Origins: Wolverine movie last night, an early Friday night show. My showing was half full, later shows looked much more full.
I enjoyed the movie, and felt I got my money's worth of entertainment. The opening credits reminded me of the opening of Watchmen.
I am not a Marvel fanboy by any means. The anti-military tropes of the Cold War and the Viet Nam war are really really dated. Last year's Iron Man was a good attempt to move on from these.
Deadpool as a wiseass was better than the finale's Deadpool-I-Have-No-Mouth-And-I-Must-Scream.
Why oh why does Wolverine have to stop and monologue in New Orleans before offing Creed? Oh, I forgot, its a superhero movie.
Professor X showing up at the end was a bit creepy. 'Nuff said.
What do I want next from Marvel? A Magneto/Iron Man team up. The two best acted roles in the Marvel film universe. Its such a natural! But it has to include Mystique, because, well, do I have to explain?
I enjoyed the movie, and felt I got my money's worth of entertainment. The opening credits reminded me of the opening of Watchmen.
I am not a Marvel fanboy by any means. The anti-military tropes of the Cold War and the Viet Nam war are really really dated. Last year's Iron Man was a good attempt to move on from these.
Deadpool as a wiseass was better than the finale's Deadpool-I-Have-No-Mouth-And-I-Must-Scream.
Why oh why does Wolverine have to stop and monologue in New Orleans before offing Creed? Oh, I forgot, its a superhero movie.
Professor X showing up at the end was a bit creepy. 'Nuff said.
What do I want next from Marvel? A Magneto/Iron Man team up. The two best acted roles in the Marvel film universe. Its such a natural! But it has to include Mystique, because, well, do I have to explain?
Wednesday, April 1, 2009
Jean Renoir - Whirlpool of Fate
I took advantage recently of a Barnes and Noble sale on art films, and picked up a boxed set of Jean Renoir. The first one I've watched is his 1925 silent film, Whirlpool of Fate (English title). The film was interesting on a few levels. One was the view of contemporary French life. Horsedrawn barges cross the countryside, and the rich play with motorcars. The second level wsa the mechanics of the film-making. Renoir used many storytelling techniques, and there is a delightful special effects sequence in the middle of the film.
By modern standards, the final resolution might not seem very cathartic. The foul uncle of the damsel in distress is knocked into the river and swept off shaking his fist, and said damsel is taken along on a trip to Algeria by the family of her wealthy benefactors. But has she actually married the handsome young scion? To me it is unclear. Perhaps to contemporary audiences, her change of dress, and riding with the family in their carriage are sufficient clues that she is now a part of the family by marriage. To me, the fact that the film skips any explicit symbols of marriage, even a swinging church bell, leaves it ambiguous whether love has successfully bridged class differences.
While I greatly enjoyed the special effects sequence, for me the greatest enjoyment in the first few seconds of the film after the titles. Leaves flashing on the trees just out of sych with the film rate create this impressionistic shimmer on the screen that immediately transported me to another place and time, not only of story, but of story-telling.
By modern standards, the final resolution might not seem very cathartic. The foul uncle of the damsel in distress is knocked into the river and swept off shaking his fist, and said damsel is taken along on a trip to Algeria by the family of her wealthy benefactors. But has she actually married the handsome young scion? To me it is unclear. Perhaps to contemporary audiences, her change of dress, and riding with the family in their carriage are sufficient clues that she is now a part of the family by marriage. To me, the fact that the film skips any explicit symbols of marriage, even a swinging church bell, leaves it ambiguous whether love has successfully bridged class differences.
While I greatly enjoyed the special effects sequence, for me the greatest enjoyment in the first few seconds of the film after the titles. Leaves flashing on the trees just out of sych with the film rate create this impressionistic shimmer on the screen that immediately transported me to another place and time, not only of story, but of story-telling.
Monday, March 9, 2009
Wrestling with a superhero origins story
Since joining the SFABC and the excellent Writers of the Weird writing group, I've written two SF stories which I'm quite happy about. I've collected one polite rejection, which is also ok.
Now I'm thinking about a new story that is actually a comic book superhero story! I'm not a real spandex-clad fanboi, so this is something of a departure for me.
All I've got right now is the gimmick that creates Our Hero. Our Hero is actually a mild mannered nobody-in-particular until they die, and then are saved by an emergency heart transplant. The gimmick is that they receive the heart of a dead superhero!
So far the dead hero is named Aurion. I don't know much about him so far, except he has golden blood, psionic powers and he's dead. Oh, he's also from somewhere in the EU, because he's a member of a Euro supersquad. Other members
Now I'm thinking about a new story that is actually a comic book superhero story! I'm not a real spandex-clad fanboi, so this is something of a departure for me.
All I've got right now is the gimmick that creates Our Hero. Our Hero is actually a mild mannered nobody-in-particular until they die, and then are saved by an emergency heart transplant. The gimmick is that they receive the heart of a dead superhero!
So far the dead hero is named Aurion. I don't know much about him so far, except he has golden blood, psionic powers and he's dead. Oh, he's also from somewhere in the EU, because he's a member of a Euro supersquad. Other members
- Bruit - think Thing, but French. "Bruit, le smash!"
- Accelerondo - think Flash, but Italian.
Need more Euros, right?
ps - don't take this too seriously!
The Origami of Life
I just wanted to share my experience with this participatory science project.
Folding@Home is a protein folding research project that is part of Stanford University. While understanding how proteins fold up into their three dimensional shapes is very important, it is also very difficult. The process in the cell takes place in microseconds as the proteins are synthesized from the instructions in messenger RNA (copied from the DNA in the nucleus). Therefore the method of choice today is to simulate the motions of the atoms using computers.
Obviously, this takes a lot of computer power. More than even the largest supercomputer, in fact. So the only alternative is to reach out to thousands of PCs and borrow their spare CPU time. Modern computers are idle most of the time. Even when browsing the web and listening to music through your computer, its processor is just idling away. Distributed computing, also called grid computing, is a way to use those spare cycles to do some good.
Folding@Home is the largest distributed computing project in the world today. Anyone with a PC, laptop, or Sony PS3 and an internet connection can join. The joint efforts of hundreds of thousands of volunteers create a computing engine that is currently five times faster than the biggest supercomputer!
I recently joined, and it is very satisfying to know that for the cost of the electricity to leave my PC on, I am contributing in a significant way to curing Alzheimer's Disease, Mad Cow Disease, Huntington's Disease, studying cancer, and advancing basic science.
To join, I went to the F@H web page http://folding.stanford.edu/English/Download to download and install the right F@H client for my machine and operating system. Now F@H just sits in the background while I use the PC normally. Because F@H only uses the spare cycles on the machine, it never interferes with other uses. I can also pause F@H whenever I want.
As you might expect of a grid computing project, the security of the software is a top priority. The software has been downloaded over 800,000 times, and no one has ever gotten a computer virus from joining F@H.
Anyone reading this message probably has all that it takes to participate in F@H. Please try it. It's fun and rewarding to see the molecules your PC is working on, and to earn points for completing work. But the real reward is knowing that you are helping to make life better, one spare cycle at a time.
ps - SETI@Home is a similar project aimed at detecting signals in radio waves collected from the Arecibo radio telescope.
pps - This is not meant to be an internet chain letter, but obviously a volunteer grid computing project grows mostly by word of mouth. If you try F@H and like it, you have my permission to forward this message to your friends, or use parts of it to convince the powers that be at local school districts and college campuses that F@H is safe, fun, and something that can make kids excited about science. PCs in classrooms are exactly the kind of underutilized resource that would greatly benefit Folding@Home.
Folding@Home is a protein folding research project that is part of Stanford University. While understanding how proteins fold up into their three dimensional shapes is very important, it is also very difficult. The process in the cell takes place in microseconds as the proteins are synthesized from the instructions in messenger RNA (copied from the DNA in the nucleus). Therefore the method of choice today is to simulate the motions of the atoms using computers.
Obviously, this takes a lot of computer power. More than even the largest supercomputer, in fact. So the only alternative is to reach out to thousands of PCs and borrow their spare CPU time. Modern computers are idle most of the time. Even when browsing the web and listening to music through your computer, its processor is just idling away. Distributed computing, also called grid computing, is a way to use those spare cycles to do some good.
Folding@Home is the largest distributed computing project in the world today. Anyone with a PC, laptop, or Sony PS3 and an internet connection can join. The joint efforts of hundreds of thousands of volunteers create a computing engine that is currently five times faster than the biggest supercomputer!
I recently joined, and it is very satisfying to know that for the cost of the electricity to leave my PC on, I am contributing in a significant way to curing Alzheimer's Disease, Mad Cow Disease, Huntington's Disease, studying cancer, and advancing basic science.
To join, I went to the F@H web page http://folding.stanford.edu/English/Download to download and install the right F@H client for my machine and operating system. Now F@H just sits in the background while I use the PC normally. Because F@H only uses the spare cycles on the machine, it never interferes with other uses. I can also pause F@H whenever I want.
As you might expect of a grid computing project, the security of the software is a top priority. The software has been downloaded over 800,000 times, and no one has ever gotten a computer virus from joining F@H.
Anyone reading this message probably has all that it takes to participate in F@H. Please try it. It's fun and rewarding to see the molecules your PC is working on, and to earn points for completing work. But the real reward is knowing that you are helping to make life better, one spare cycle at a time.
ps - SETI@Home is a similar project aimed at detecting signals in radio waves collected from the Arecibo radio telescope.
pps - This is not meant to be an internet chain letter, but obviously a volunteer grid computing project grows mostly by word of mouth. If you try F@H and like it, you have my permission to forward this message to your friends, or use parts of it to convince the powers that be at local school districts and college campuses that F@H is safe, fun, and something that can make kids excited about science. PCs in classrooms are exactly the kind of underutilized resource that would greatly benefit Folding@Home.
Tuesday, January 15, 2008
Hello World
Don't expect much from this blog. I'm not huge on reguritating my life into an open diary, and I'm not the author of bons mots every day.
I'm going to try to focus the blog on the intellectual areas I care most about. Right now, this means genetic algorithms, cryptography, defending evolution from misguided attacks, XBRL, and a very small dab of politics. Arts and letters will get a passing mention. I'm interested in comics (and manga, and anime), backing into the subect from the perspective of UI design, Tufte, Scott McCloud and Takahashi Rumiko.
Thanks for reading! I hope you'll be back.
I'm going to try to focus the blog on the intellectual areas I care most about. Right now, this means genetic algorithms, cryptography, defending evolution from misguided attacks, XBRL, and a very small dab of politics. Arts and letters will get a passing mention. I'm interested in comics (and manga, and anime), backing into the subect from the perspective of UI design, Tufte, Scott McCloud and Takahashi Rumiko.
Thanks for reading! I hope you'll be back.
Subscribe to:
Posts (Atom)