Showing posts with label intelligent design. Show all posts
Showing posts with label intelligent design. Show all posts

Thursday, October 4, 2012

Evolution: A view from the 21st Century by James A. Shapiro, reviewed by David vun Kannon

In this slim book, eminent bacteriologist James Shapiro attempts to communicate his view of the most important drivers of evolution for a non-specialist readership. The material is dense, mostly because the text does not rise much above an outline of all discovered processes of genetic variation, no matter how obscure.

Shapiro succeeds in conveying the idea that variations arising from genetic change other than uniformly distributed single nucleotide changes are the most important to understanding the diversity of life today. However, his other agendas, such as displacing Crick's Central Dogma of Biology, are not successful.

Let's deal with some of the positives of the book first.

Shapiro is writing for a wide audience, and does not shy away from addressing some issues related to the "Intelligent Design" controversy. Some in the ID community initially took Shapiro to be their friend, in the "enemy of my enemy" sense. However, Shapiro takes the age of the planet and the evolution of life as ground facts.

The book makes extensive use of online appendices and additional reference material. I read the book on the Nook e-reader from Barnes & Noble, and opening the book using the PC version of the Nook reader application made these materials easy to access. Much of the online reference material is linked directly to Pubmed. Online additional readings link mostly to articles from Scientific American - not the primary literature, but an accessible source for the expected audience. These articles span 60 years of publication and many are of historical interest only.

The book is very complete in its coverage of genomic change processes. And while Shapiro's main point is to focus on sources of variation other than point mutation, when it comes to discuss mutation, the book includes intriguing sources such as viruses (in which mutation can happen at much higher frequencies).

Most readers will probably be quite surprised by the importance of genomic processes other than mutation in shaping the course of evolution. Even if you've been following the developments as an interested non-professional, as I have, the variety of processes discussed is sure to teach you something new.

One insight I got was that the machinery that is used to guide protein production inevitably interacts with the machinery of cell duplication (in single celled organisms) and germ line continuation in metazoa. I failed to see previously how often the genome is opened up and read, and how that necessary process creates the chances for things to break and be repaired differently.

However, it must also be said that the book is far from perfect. Indeed, there are many irritations that spoil the enjoyment of learning.

Shapiro seems to feel that it is his job to carry forward the mantle of "unorthodox biologist" worn by Lynn Margulis and Barbara McClintock, among others. He takes several shots at "evolutionists" for missing the importance of jumping genes and symbiosis, while focusing on the population genetics of single random changes.

With all due credit to McClintock and Margulis, Shapiro's rhetorical stance is unhelpful. He does play into the hands of those that would willfully misrepresent his position by using loaded terms such as Darwinism and evolutionist, without defining them and apparently without concern with how these terms have been used in the popular press. If Shapiro means "evolutionary biologist" when he says evolutionist, he should use the less charged term.

Shapiro repeatedly uses a "microprocessor" metaphor that is painfully inappropriate. A computer CPU is a piece of hardware that can execute any series of instructions stored in memory, given a link to the first address of where to fetch the data. The information of the genome is the data, not the hardware that reads or  acts on the data. The closest thing in the cell to a CPU is the set of molecules that read, transcribe and translate, DNA into protein - the ribosome.

There are many ribosomes working in parallel in the cell, one of several failures of the analogy. As a system, the protein production and genetic machinery are more like a "production system" - a set of if-then rules that work in parallel. This is software, not hardware, but it fits better.

Scientists frequently stretch to find an analogy which will work for a lay reader, to help the reader understand their work. If that is what Shapiro was trying to do, it doesn't work. If he actually thinks the genome instantiated in a cell is a microcircuit, he is sadly mistaken about microelectronics.

Few, if any, people would call a microprocessor "aware", "intelligent", or capable of cognition, yet this book does use such aggressively telic language with respect to the cell and the genome. However, we should only be willing to talk about "cell cognition" if we are also willing to talk about "thermostat cognition". The feedback loops elaborated in the cell are only marginally more complex than your friendly household appliance.

Darwin comes in for some criticism that seems unnecessary, sort of like criticising Newton for not discussing relativity. Yes, Darwin's uniformitarianism was/is a simplification of what we know today, and did reflect philosophical debates of his time. So what? Does this need to be criticised or simply acknowledged?

Repeatedly when dismissing the random mutation of single nucleotides, Shapiro seems to confuse random with 'uniformly distributed' - or read that confusion onto others. We know that SNPs (single nucleotide polymorphisms) are not randomly distributed. They are more likely in some parts of the DNA string than in others. However, they are random, in the sense that we don't know in advance where a change will take place, even if we know they take place at different frequencies. As an analogy, we know that a sample of a radioactive element has a half-life, but we don't know which atom will decay next.

Shapiro seems unconcerned with the Darwinian distinction between selection and sources of variation, giving all the credit to the multiple sources of variation, and little or none to the various forms of selection that can act on an organism. There is also no discussion of the "evolution of evolvability" as a framework for understanding the many mechanisms that are cataloged in the book.

A weakness in the writing is to describe the genetic machinery as "indescribably complex" before launching into a description of it! Phrases like 'indescribably complex' are just more fodder for quote mining by creationists. Similarly, Shapiro's overall anti-reductionist stance obscures the fact that all of the data and research are based on a reductionist paradigm - the genetic machinery of the cell is entirely the arrangement of atoms and the forces acting upon them, as is everything else in the cell. There is no vital elixir or special sauce that defies reduction to these terms.

While referring to it several times, Shapiro never successfully attacks the Central Dogma of Biology, that information flows in the direction of DNA to RNA to protein, but not in reverse. There are ample examples given of proteins attaching to and regulating the genome, but those proteins are always created by the genome.

Relevance to the ID debate

The book does mention Intelligent Design. However, it also treats evolution as a fact. Natural genetic engineering, as Shapiro calls it, is the source of variation used by evolution. These large scale additions and rearrangements are the driver of metazoan evolution - not new sequences.

It has been the mistake of ID supporters to try to find an ally in Shapiro. Obviously, they did not read the whole book, or if they did their memory is quite selective as to its contents.

It should be mentioned that Shapiro published two papers with controversial ID figure Dr. Richard von Sternberg in 2005. Sternberg is thanked in the acknowledgements.

Shapiro also indulges in some 'bignum' argumentation. This is the sort of handwaving probability calculation that concludes that "there is not enough time" for base-by-base change to create the evolutionary results we see. This kind of reasoning has often been proved wrong, usually by pointing out that sexual reproduction allows many changes to be selected in parallel throughout a population and combined, and high rates of reproduction and HGT (horizontal gene transfer) accomplishing the same thing in bacteria.

Indeed, Shapiro's own discussion of viruses as sources of variation for other life does not examine the sources of variation in viruses - uncorrected random mutation.

The telic language, anti-"Darwinism", and "gee, its complicated" attitude are all ID friendly, but in the end Shapiro has a clear vision of who the Intelligent Designer is, and it is the cell itself.

Relation to the GA software paradigm

Much of conventional Genetic Algorithm software is explicitly point mutation based. Mutation and crossover are often the only operators used, and usually mutation is uniform along the genome. This is the strawman view of genetics that Shapiro criticizes most sharply.

I think the book can be read as a set of suggestions for improving our GA algorithm design if we want to achieve more than numerical optimization with GA. Here are some taking off points that I see:


  • exon/intron distinctions, and redundant representations
  • germ/soma distinctions
  • both of the above presuppose a more robust genotype/phenotype distinction
  • development of that phenotype aka evo-devo GAs
  • fitness testing at multiple points during a phenotype's lifetime
  • gene regulatory networks - genetic operators for regulation of the genome


In conclusion, a book well worth reading and thinking about, even with the annoyances and idiosyncrasies of the author.

Tuesday, June 19, 2012

Barhaminology: The Bioessentialist Manifesto

Over at his TheBestSchools.org blog, James Barham continues to entertain us with armchair philosophy. In this episode, his view of what biology is really all about.

Barham sets up two views, the Darwinian view, and the bioessentialist view. Guess which one he prefers?


The Darwinian View of Life
  • There is no deep difference between living and nonliving matter; therefore, it is idle to seek “essential” properties or a “definition” of life.
  • In any case, the most fundamental fact about a living thing is its ability to undergo natural selection.
The Bioessentialist View of Life
  • There is a fundamental difference in kind between living and nonliving systems; the main task of biology is to understand the distinctive nature of living matter.
  • The most fundamental fact about a living thing is its ability, by doing work selectively, to maintain itself in existence as the kind of physical system that it is.

Dismiss in passing Barham's purposeful confusion of Darwinism and materialism. Let's go to the videotape! Anyone remember the search for elan vital? It doesn't exist. Living things are made of the same atoms as non-living things. Use the same chemical reactions. Watch the same TV shows. Mr Barham seems to have forgotten that.


Oh, sorry, I didn't notice that the Darwinian was looking at 'matter' and the bioessentialist was looking at 'systems'. For a philosopher, Barham has a tough time setting up his comparisons.


"The main task of biology" - James Barham, armchair philosopher and web technician, has pronounced. It must be so.


"by doing work selectively," - selectively? A bacteria only eats half the available sugar? A virus only makes half the copies of itself that it could? Sperm cells only swim as much as they want? Barham might work selectively but it hardly qualifies as a definition of life.


(My own definition of life, FWIW: Life is a collection of molecules working together to avoid equilibrium for as long as possible.)


The essay is quite long and continues to be silly in the same vein. Genes are contrasted with proteins because metabolism is more important than reproduction. WTF? Since when was living forever an option? Metabolism explains the fossil record, biodiversity, the peacock's feathers and the panda's thumb?


Barham and his dog Marty are not, apparently, made of quarks descended from the Big Bang. Perhaps they were specially created 6,000 years ago. Who knew? Marty ain't made from no quarks! Reductionism is defeated.
For example, they are all explained at a more fundamental level by the Pauli exclusion principle.
Except when it is convenient.

In the case of a true machine, the functional order has nothing whatever to do with the matter out of which the machine is composed. It is imposed upon the matter entirely from without—by us. The material parts out of which a machine is made are supremely indifferent to the purpose the whole is designed by us to serve. Moreover, the stability of a machine resides in the rigidity—not the flexibility, much less the inherent intelligence—of its parts.
In contrast to what happens inside a machine, everything that goes on within a living being possesses an inherent purpose—namely, maintaining the organism in existence. That is the essential difference between living and nonliving things.

So living things are NOT machines. Just don't tell Polanyi and all those folks that want to argue that living things ARE machines, because machines are designed.


Don't quit the web job, James. Armchair philosophy, it ain't for you.

Wednesday, April 25, 2012

Hairpin RNA

Another entry in the "is function arbitrary" series...

One of the most commonplace motifs in RNA molecules is the hairpin. The basic idea is this: the 'primary' structure of a strand of RNA is the sequence of bases, GCAU. But function doesn't depend on the primary sequence. That sequence has to be folded up into three dimensions - the 'tertiary' structure. In between primary and tertiary, we have the secondary structure, which captures most of the bonding between nucleotides in a flat, 2D picture.

An RNA hairpin's primary structure is like a palindrome, the beginning and end are mirrors of each other. For example:

GUGCCACGAUUCAACGUGGCAC

Looks like:
(Credit Wikipedia, article 'Stem-Loop')

It just isn't that hard for these things to form by chance. An example such as the above, with an 8 base pair stem, has a 1 in 64,000 chance of forming in a random chain. That might not sound like a lot to us humans, but to molecules where gazillions can be held in a drop of water, a lot hairpins can form! 1 in 64K is way way lower than William Dembski's Universal Probability Bound of 1 in 10^150, so even he would agree that no "Intelligent Designer" is necessary.

So if 1 in 64K of short (11 base pair) primary sequences forms a hairpin secondary structure, how many of those show stability and biological function as a tertiary (3D) structure? A good question. "Function" can be based on the choice of the base pair at the bottom of the stem, the stem pairs, and the top. But it is clear that even small, simple molecules such as these can have significant function, as shown by the existence of ribozymes (enzymes made of RNA) such as the Hairpin or Hammerhead ribozyme.

Further, really important molecules such as transfer RNA are simply 4 hairpins stuck together like Lego blocks. This structure can be broken down into the "top half", consisting of two of the hairpins, and the "bottom half", the other two. These halves could have evolved independently and then acquired new functionality when they stuck together.

A key message of ID and pure creationist propaganda is that the system of replication used in cells today is too complex to have arisen without guidance by a Creator. Looking at the reality of RNA hairpins, we can see that this is not true. A key piece of our current replication machinery is cobbled together from smaller parts that could easily have formed by chance, and then been retained for their function.

RNA vs. Jenga!

I recently spent some time talking about binding affinities in molecules such as DNA, RNA, and proteins. I said previously that there wasn't any differential binding affinity from one base pair to the next.

That turns out not to be the case. (aka FAIL) There _are_ base stacking interactions that can stabilize DNA and RNA molecules. These means that some sequences will be more likely than others in the real world.

The situation can be explained with an analogy to human language. This is good, because Polanyi worshipers love this analogy. In English, Q is followed by U consistently. That is a complete affinity. We can also talk about an affinity between two classes of letters, those representing consonant sounds and those representing vowel sounds. A string of letters is more likely if it contains alternations between these two classes.

Why is that? Well, in written English you'd be wrong to imagine that the choice of letter order was entirely arbitrary, it obviously isn't. (If it was, we wouldn't be able to compress English text very well, which is obviously not the case.) Written English derives from spoken English, and it is a lot easier to transition from one consonant to another through a vowel sound rather than directly. If you disagree, try the Czech phrase "StrĨ prst skrz krk" which translates roughly as "stick a finger in your throat".

From here, we can see that Polanyi's analogy was a FAIL to begin with, since the thing he wanted to analogize to, human language, does show constraints based on physical properties of the world and is not an arbitrary symbol system.

And Jenga!? Obviously, the choices you make in this block stacking game are not arbitrary, either. Every player knows that a stack built of "middle" bricks is going to be very unstable.

Friday, April 13, 2012

No error bars, no science

There is a meme circulating in the skeptics of global warming blogosphere - "no error bars, no science" which is meant as a criticism of papers they disagree with. A laudable concern in general, but what is good for the goose is good for the gander. 

Apply the same idea to ID, friends. What is the error bar on "Goddidit"? If ID would like to be considered a scientific topic, what error bars will Dembski, et al. attach to their work?

Tuesday, April 10, 2012

Moshe Averick Helps Meyer Hide the Afikoman of Understanding


Signature in the Cell, Stephen Meyer's gift that keeps on giving. Published in 2009, this book stirred up some controversy at the time over its review of Origin Of Life (OOL) theories and crowning of ID as the "best explanation".

Recently, the book was reviewed by British geneticist Richard Saunders on his blog, Wonderful Life. This review attracted the attention of the Discovery Institute and one of the DI's pilot fish, Moshe Averick. Averick wrote a scolding rejoinder to Saunders, earning him a pat on the head from David Klinghoffer over on Evolution News and Views.

(An aside. Averick deserves some respect, not for the validity of his opinions or his choice of culture war bedmates, but for having the guts to write in a forum that accepts comments. Most of the DI propaganda machine operates in the criticism free zone of their own web sites, no comments allowed. The same tip of the hat goes to Cornelius Hunter, the Baghdad Bob of anti-Darwinian creationists. Hunter's agit-prop is completely disengaged from the stated moral code of his religion, but he does allow comments to his blog!)

I'm not going to try to fisk Averick's piece, it doesn't deserve that much attention. I am going to focus on the issue of Meyer's discussion of differential binding affinities, since it was one of the points about Saunder's review that Averick jumped on.

Wow, "differential binding affinities"... I can hear your eyes glazing over already. Half my readership just left to check their Facebook pages, and there was only two of you in the first place!

Yes friend, "differential binding affinities" is actually one of those important places in Signature in the Cell where Meyer connects his philosophy to real world science, showing the roots of the Intelligent Design movement.

Stepping back for a moment, one of the big ID arguments is that everything has to be explained by one of three drivers, chance, necessity, or Design. If we can eliminate chance and necessity, we are forced to choose Design as the best explanation.

So what are differential binding affinities? We know that DNA uses a four letter alphabet, ACGT. In a real DNA molecule, A and T pair up, as do C and G. These pairs are on the inside of the famous double helix shape. They are the rungs of the twisting ladder. The outside of the helix, where each pair is connected to the next pair, is made of phosphate molecules.

If I told you that one 'rung' of the helix was A-T, could you predict the next rung? Not really. There are four possibilities (A-T, T-A, C-G, and G-C) and they are all equally probable. That is the opposite of a differential affinity. In a differential affinity, A-T might be followed 50% the time by T-A, and never by G-C.

Meyer connects this idea to two different strands of thought. One is the idea that either the proteins or DNA sequences of life exist by necessity - because there is no other way to make the pieces fit together. Meyer attributes this idea to Dean Kenyon as an early (1980s) OOL explanation. My research can't confirm whether this idea actually had any followers. 

I admit that I am a bit suspicious since Kenyon, now a creationist, works with Stephen Meyer at the Discovery Institute. Bringing in Kenyon's work gives Meyer a strawman to knock down and an opportunity to play the sympathy card for Kenyon, who faced some strong criticism for mixing in creationism in his evolution courses.

The other connection is with the philosophy of Michael Polanyi. Polanyi was a well respected chemist and philosopher of science, but apparently had a thing about evolution. He wrote an essay, "Life's Irreducible Structure", that is very influential to the ID movement. It is to this essay that Meyer links the binding affinities issue, since to him it affirms the position of Polanyi that information is not reducible to structure, the "physico-chemical" laws of the universe.

This is (finally!) the important point of this section of Meyer's book. It is important to Meyer, and that is why it gets the "revelation from on high" treatment that Saunders objects to in his review, mentioned above.

Sorry, your afikoman is in another castle!

Since Averick is not shy about his rabbinic degree, I'll use a timely Jewish analogy. During the Passover seder, the leader hides the afikoman, a piece of matzah that will be used to complete the rituals later in the evening. Meyer (not Jewish, BTW) is also hiding something, and Averick is only too happy to help him do it. What is that something?

Meyer's book is about the origin of the genetic code. That is the "signature in the cell". The genetic code maps triplets of RNA nucleotides (AGC, for example) to the 20 or so amino acids that are used to build proteins. But Meyer is hiding something about nucleotide triplets and amino acids, and if you guessed "differential binding affinities" you win!

Here's the basic idea. Make some long repeating strands of RNA, such as ACTACTACT... . Now stir in different amino acids. In water, all the RNA and amino acid molecules will be in constant motion, bumping into each other in various ways. Sometimes they might stick briefly to each other before the water molecules push them apart. That length of time is their biding affinity and it is not the same for all combinations. Some combinations of triplet and amino acid are much more likely to stick together than others.

What does this mean? Say we had a little OOL scenario, warm pond, all the amino acids floating around and some short random RNA sequences as well. One of those RNAs is AUGGCC, for example. The AUG will prefer to stick to the amino acid Methionone, while the GCC will prefer to stick to Alanine. At some point, both a Methionone and an Alanine are sticking to this little RNA long enough for them to link together spontaneously. Now instead of two amino acids we have one small protein. 

The point here is that the differential stickiness of RNA and amino acids did not have to be "Designed". It is inherent in the physics and chemistry of the world. Polanyi was wrong. The genetic code was not "Designed", it flows naturally from these differential binding affinities.

What I've sketched out in the preceding paragraphs is called the "stereochemical hypothesis", and is an active research topic for OOL scientists such as Michael Yarus. (It is active because more evidence keeps accumulating that it is correct.) Meyer claims to be giving a thorough survey of all OOL work in his book, as a matter of fact his argument _requires_ him to survey all possible options and find them inadequate before he can conclude that Design is the best explanation. But just like the seder leader hiding the afikoman, Meyer has hidden any discussion of the stereochemical hypothesis (and most of the rest of the modern research on the RNA World) from view in his book.

Averick, the cheerleader and pilot fish, is only too happy to help do the hiding. He doesn't know the stereochemical hypothesis from a hole in the wall, but if Meyer is going to pound on about no differential binding affinities in DNA, Averick is there pounding also.

Thursday, June 23, 2011

The Facepalm of Compensation

Readers here and elsewhere will know that Dr Granville Sewell thinks there is a problem with biology and the Second Law of Thermodynamics. He has written several versions of an argument claiming that the Second Law poses a problem for biology, especially the origin and development of life on Earth.

Dr Sewell is not alone in this concern. Generations of creationists have had this concern. However, the answer given is so obvious that even creationist bastions such as the Institute of Creation Research no longer recommend using this issue in debates. That answer is that SLoT only applies in closed systems, and the Earth is not a closed system. The surface of the planet receives energy from the Sun, energy from its core (from radioactive decay and residual heat of friction) and these sources overcome the trend towards higher entropy.

Dr Sewell has attempted to avoid this answer by arguing in several ways. One is to try to apply SLoT to an open system. Another is to attack the idea of compensation that appears in some elaborations of the answer given above.

Dr Sewell's argument is that even an open system MUST rely on passage through the boundary of anything that that is going to increase inside the system.


If an increase in order is extremely improbable when a system is closed, it is still extremely improbable when the system is open, unless something is entering which makes it NOT extremely improbable.

The above quote is from Dr Sewell's Can ANYTHING Happen in an Open System?

One of the biggest problems with this argument, which Dr Sewell has called his controversial tautology, is that it expands SLoT to cover any diffusion problem at all. We can break this down into two sub-problems, expanding SLoT and treating the issue as a diffusion problem.

Can SLoT be expanded to cover anything beyond thermal entropy? Obviously, Dr Sewell says yes here, and in his invocation of "X-order" in the AML paper. At the same time, in a later article he criticizes Dr Dan Styer for allegedly applying SLoT broadly. He has perhaps learned something, since most scientists would agree that you can't, willy nilly, go applying conservation laws wherever and whenever you feel like it.

Secondly, not all of the universe is a diffusion problem. Let's say that my open system of choice is a crowded bar, and I'm interested in the amount of whiskey in the bar as whiskey diffuses across the boundary I've drawn around the bar. Is the amount of whiskey in the bar solely dependent on the amount crossing the boundary? Obviously not, it also depends on the rate at which it is consumed within the bar, the rate at which sober customers (who are not, themselves, made of whiskey) arrive, and the rate at which inebriated customers (partially made of metabolized whiskey) exit.

What is true of whiskey is also true of cosmic rays, high energy photons, radioactive atoms, and many other things. They can enter through a boundary around an open system, but there are significant transformational processes that can occur within the system as well. So Dr Sewell's controversial tautology is neither controversial nor a tautology. It is simply wrong.

This is why Dr Sewell's argument fails at explaining photosynthesis. Similar to the crowded bar, we draw the boundary around the cell wall of a cyanobacteria. Light enters at one frequency, strikes various molecules, is absorbed, its energy is changed into thermal motion and the potential state of various electrons, sugars are produced and eventually a low energy infra-red photon exits the boundary. Sugar did not enter across the boundary. A low energy photon did not enter across the boundary. The quantity of high energy photons inside the boundary has not increased.

This brings us to compensation. We can say that the exit of the low energy photon "compensates for" the sugar. There is an energy difference between the high energy photon that came in through the boundary, and the sugar molecule. If we add in all the thermal motions and escaped photons, we should be able to make the energy equation balance.

But not the order equation. Even though the sugar molecule has lower entropy, the universe as a whole is worse off.

Dr Sewell seems to think that compensation can happen at a distance. It doesn't. Dr Styer says in his article:


Presumably the entropy of the Earth’s biosphere is indeed decreasing by a tiny amount due to evolution, and the entropy of the cosmic microwave background is increasing by an even greater amount to compensate for that decrease.

Does this mean that Dr Styer is engaged in some magical thinking that life here makes the CMB colder via some spooky action at a distance? No. Dr Styer previously wrote:


The Sun heats the Earth through electromagnetic radiation  largely in the visible and near-infrared bands . The Earth radiates electromagnetic radiation largely in the far-infrared band into outer space, where it eventually joins the cosmic microwave background.

So it is clear that the CMB effect Dr Styer is referring to is based entirely on the passage of sunlight through the biosphere of the Earth. Yes, the CMB observed by someone distant from the Earth will have higher entropy than if the same sunlight had struck a dead planet of the same size and location.

Compensation is not action at a distance. You can always trace the interactions back to the point where one high entropy and one low entropy component were created, and see how the high entropy component escaped the open system. In considering the overall accounting for entropy in the closed system (the Universe) within which our open system is embedded, the escaped component is compensation for the low entropy component it left behind. It is only in this overall perspective that we need to worry about compensation, since it is only in this closed system that we need to be concerned with SLoT.

These misunderstandings and logical fallacies have led Dr Sewell to embarrass himself once again, by writing to the journal that published Dr Styer's article, the American Journal of Physics. In a blog entry on Uncommon Descent, Dr Sewell calls AJP a "major physics journal". In fact, it is a journal for articles related to teaching physics to high school and college students. The rejection message he received makes that clear, as well as making clear the overall high crank science level of his writing.

Monday, June 20, 2011

Model Madness: Axe vs. Lynch and Abegg

I recently blogged about a paper by Lynch and Abegg 2010, which I thought was an important paper. It showed that, yes, there was time enough for evolution, mainly because neutral and even maladaptive variations could accumulate in sufficient numbers until they finally coalesced into a new beneficial function.

Douglas Axe, a leading scientist within the ID community, responded to the challenge inherent in this paper. Axe's position and research agenda has long been that there is not time enough for evolution.

At this point, I have to say that even though I disagree with Dr Axe, I give him credit for being the most professional and rigorous pro-ID scientist I have ever read. Yes, professional scientists can work themselves into a corner that eventually becomes crank science as they refuse to abandon a position - witness the Rubin group at the University of Oregon on "birds are not dinosaurs". Yes, I do think Axe is in this position, but he is trying in a principled, scientific way to address the issues. As such, he has demonstrated far more professional integrity than Stephen Meyer or William Dembski, neither of whom is a scientist.

Axe's response is The Limits of Complex Adaptation: An Analysis Based on a Simple Model of Structured Bacterial Populations, which attempts to criticize Lynch and Abegg and to propose an alternative model.

For now, I'd like to focus on the differences in the models. Lynch and Abegg use a model assuming sexually reproducing diploid populations. Axe tries to refute them with an asexually reproducing haploid island population model. Are those differences appropriate?

One way to answer would be to look at the biochemistry that is being discussed, and ask when did it evolve. Is it eukaryotic or prokaryotic in origin? As I pointed out in my last post on this, eukaryotic sexual species with large populations have been around for a billion years. The larger portion of the biochemistry we operate with is eukaryotic - not shared with bacteria.

That calls into question the basic assumption of Axe's model. Another way to look at the issue is to question the realism of the asexual population genetic abstraction. We now know that in real life, as opposed to the test tube or a mathematical simplification, bacteria exchange genes rapidly. The process might be based in conjugation, or it might be through viral infection. In either case, the binary fission model of where genes come from isn't relevant.

Axe's model also incorporates an effective population size that is quite small - 10^9, a billion bacteria. This is justified by appealing to the island model dynamics of Maruyama and Kimura 1980. Even accepting these dynamics, a gene's eye view of the world has to incorporate the reservoirs afforded by other species and viruses. So I would argue that Axe's effective population size is too small.

Wednesday, June 8, 2011

Time Enough for Evolution: part n++

The Rate of Establishment of Complex Adaptations
Michael Lynch, and Adam Abegg 2010

Several points about this important paper:


  • The concerns of evolution critics are addressed in the scientific literature. The paper mentions the critique of Behe and Snoke (2004) as a motivation.
  • The particular set of population genetic models discussed are based on sexual reproducing populations of diploid chromosomes. We are familiar with sexually reproducing organisms as large plants and animals, and therefore the charts in the article which show effective population sizes up to 10^11 individuals may seem alarming. But consider that there are many single celled sexually reproducing plants, animals, and fungi (protists, generally), and that even one trillion (10^12) eukaryotic cells take up less space than the human body.
  • Single cell protist sex has probably been around for a billion years.
  • The evolutionary features we find most striking are at the edges of the vast conserved biochemistry of life. We look at changes in timing and rate of developmental signals that can change a tapir into a giraffe, but these don't require new biochemistry.
Taking these points together, this paper is an important answer to the 'no time for evolution', bignum crowd.

Granville Sewell's SloT article: Zombie or Persistent Vegetative State?

I've been apprised that the 15 seconds of Internet fame alloted to this blog has arrived, in the form of a link from John West's blog entry over at Evolution News and Views. As welcome (in the 'just spell my name right' way) as that may be, it seems that John and/or lawyer Pete Lepiscopo are confused about the issues.

Here's the text of my letter to Dr Rodin, the editor at AML.

Dr Rodin,

I am appalled to see a preprint, apparently from Applied Mathematical Letters, of the often repeated and often refuted nonsense of Granville Sewell on an anti-science web site.
http://www.uncommondescent.com/intelligent-design/elsevier-publishes-granville-sewells-latest-on-the-second-law/

Dr Sewell, whose expertise lies in partial differential equations, has writen several times on the relevance of the Second Law of Thermodynamics to the topic of evolution. Each time he makes poor arguments that do not show any understanding of the physics or chemistry involved, clearly contradicting the philosophy of your journal.

A concise refutation is
http://ajp.aapt.org/resource/1/ajpias/v76/i11/p1031_s1

The reputation of AML will be harmed by publishing this article by Sewell.

Yours,
David vun Kannon

You might notice that I don't make any request of Dr Rodin, specifically, I don't ask him to not publish. Nor do I base my argument on my own reputation in the field of evolution or thermodynamic studies (fields where my reputation is at least equal to Dr Sewell's). Rather, I supply Dr Rodin with a link to an article published in 2008.

American Journal of Physics -- November 2008 -- Volume 76, Issue 11, pp. 1031
Entropy and evolution
Daniel F. StyerDepartment of Physics and Astronomy, Oberlin College, Oberlin, Ohio 44074
Abstract:
Quantitative estimates of the entropy involved in biological evolution demonstrate that there is no conflict between evolution and the second law of thermodynamics. The calculations are elementary and could be used to enliven the thermodynamics portion of a high school or introductory college physics course.
© 2008 American Association of Physics Teachers

The above article is far more persuasive than a letter referencing it. While Sewell's lawyer might think an e-mail from a nobody blogger can move an editor to extraordinary actions, I think the credit fairly belongs with the scientific literature that was cited.

West then follows lawyer Lepiscopo into an odd series of quotes and links. For example, West states:
According to the journal's editorial policies, acceptance of an article cannot be rescinded once an author has been notified of its acceptance, and accepted articles are supposed to be withdrawn only "under exceptional circumstances" such as fraud, errors, ethics violations, and the like.
Um, yeah. Follow that "cannot be rescinded" link and you arrive at a page describing the Elsevier editorial process, which is not relevant to the situation after acceptance. Even so, the page states:
Editors with the appropriate EES permission* can rescind (undo) a decision before or after the Author has been notified, or after the final disposition has been set to Reject.
Notice the "can rescind" verb? West and lawyer Lepiscopo appear to have read that as "cannot rescind" for some reason, perhaps a reason favoring their position.

West and lawyer Lepiscopo continue by noting that errors are a valid reason for withdrawing a paper. Well, that is really the point, isn't it? While people familiar with Sewell's Johnny-one-note attack on evolution know he has been singing the same song for years (as Weseley Elsberry showed), more to the point for AML is that this version of the paper does not address the literature, specifically the 2008 paper cited above.

I am not privy to any agreement, certainly less so than John West seems to be. If Elsevier has made a pragmatic choice to buy off a nuisance lawsuit, I understand it from a business perspective. I hope it might make them review the business process that led to this fiasco, a 'rapid review' editorial workflow. I'm glad to hear that Dr Sewell is welcome to submit future articles to AML. This is a privilege that is shared by most of the population, including myself, John West, and lawyer Lepiscopo.

And what of the paper itself? According to West, it can join several of it's kin on Dr Sewell's web site. It might even say 'accepted by AML' on it. But it remains comatose. If John West wants to see how Dr Sewell and I discuss his ideas, he can look at my comments (under the pen name Nakashima) on the various threads on Uncommon Descent where the same thoughts have been floated in the past.





Monday, May 30, 2011

Spetner, Wilf, & WEASEL

Last year, a short paper was published in the Proceedings of the National Academy of Sciences (PNAS) entitled "There's Plenty of Time For Evolution". (Link goes to arXiv version of the paper.) It wasn't the best of all possible papers on the subject, and some people seriously questioned why it got published by PNAS.


The paper, by Wilf & Ewens, attempts to address the 'bignum' argument frequently used against evolution. Bignum arguments usually run along the lines of: a functional protein enzyme is at least 150 amino acids long, but if you just tested strings of length 150 with any sequence of 20 amino acids, that is equivalent to searching through 20^150 strings. Even if the universe were filled with testing apparatus working since the Big Bang, not enough time would have passed to find a single functional protein. Therefore, evolution needs the assistance of an Intelligent Designer to nudge things in the right direction, or perhaps create everything already working perfectly.


Bignum arguments have been around a long time, and they were famously taken down by Richard Dawkins in his popular book, The Blind Watchmaker. In that book, Dawkins shows that cumulative selection is the natural process which allows evolution to proceed faster than the random search model. Dawkins does this with a little computer program that has come to be known as WEASEL.


The WEASEL algorithm was simple. Generate a population of random strings. Measure their fitness. In WEASEL, this was done by comparison to a fixed string. The fittest of the population is the only one allowed to reproduce. It does this by copying itself until the population is the same size again. However, each time a copy is made, letters have a chance to change. Repeat this process for as long as you like.


The WEASEL algorithm could find strings much faster than the random model, of course. The key is remembering your good choices. The second key is using a population to test multiple possibilities at the same time.


To rebut WEASEL, anti-evolutionists have made two critiques. The first is that WEASEL uses a fixed target string. This, they say, is 'sneaking in information'. No, this is just making the example easy to understand. You can write a WEASEL-like program with a different fitness test that does not involve a fixed string. An example would be the Traveling Salesman Problem (TSP), where the fitness is the shortest path through all the cities.
The second critique is that the program protected its good choices from ever changing again, which was not a good model of mutation in a genome. A careful reading of Dawkins' description shows that he did not make this mistake. It is a side effect of using a population based model that reversions from correct letters rarely happens, but it can happen at high mutation rates in small populations.
Neither of these critiques go to the heart of the issue, that a population based model with cumulative selection is a better approximation to real biology than a random search model.


The reason for this lengthy diversion into WEASEL lore is that anti-evolutionists are not the only folks to get the algorithm wrong. Even academics trying to demonstrate evolution occasionally code it wrong by protecting the correct letters. This brings us to Wilf & Ewens.


Wilf and Ewens do use a model which protects good choices. However, what they are modeling is very different from the WEASEL model. In WEASEL, the objects were individuals in a population. In Wilf & Ewens, the object is a population itself. In a population, the process of fixation is the analog of protecting the letter. This isn't well explained in the paper. Essentially, instead of counting generations, the 'rounds of guessing letters' are rounds of selective sweeps and fixations in the population. Each of these could take many generations. Since the paper is directed at the mistakes of non-specialists, all of this should have been made much clearer.


Now along comes Dr. Lee Spetner. Spetner is a well known and well respected name in the anti-evolution field. He is an MIT Ph.D, so he has credentials that command respect and attention. Spetner has written a critique of Wilf & Ewens, but PNAS has refused to publish it, so it has been posted on Uncommon Descent instead.


Spetner's first critique is that Wilf & Ewens are attacking a mislabeled problem. According to Spetner:



They gave no reference for such a model and, to my knowledge, no responsible person has ever proposed such a model for the evolutionary process to “discredit” Darwin. Such a model had indeed been suggested by many, not for the evolutionary process, but for abiogenesis (e.g., [Hoyle & Wickramasinghe 1981]) where it is indeed appropriate. Their first goal was not achieved.
First, lets thank Dr Spetner for pointing out that evolution and abiogenesis are two different things, two different issues. Many are the anti-evolutionists who cannot make this distinction. However, the bignum argument has been used often against evolution, also. For example, Douglas Axe, Michael Behe, and Stephen Meyer all use it. These people are not 'responsible', apparently. Spetner should inform the Discovery Institute of this!


Since we see that bignum is used against evolution, Spetner's own first critique fails.


Spetner's second critique is more serious. According to Spetner, the selective sweep and fixation of one improvement cannot be achieved until the last sweep is finished. Therefore, fixation of multiple genes must proceed in series, returning us to a bignum argument.


I think a big part of the disagreement here is that Spetner is assuming an asexually reproducing population, while Wilf & Ewens are assuming a sexually reproducing population. Neither the original paper or the critique make this point clear, but that is the simplest reading to me.


You can go on to question Spetner's reasoning, even in the asexual case. First, lateral gene transfer means that in reality, even asexually reproducing bacteria have many 'parents', so genes mix much more quickly than a pure, asexual, mutation driven process on paper. But even in the pure case, assume that a mutation is present in 90% of the population - it has almost taken over, but not quite. Certainly, a new mutation of another gene could arise within that 90% and begin a new selective sweep of its own. How would it 'know' to wait?


Spetner's argument is also couched in terms of the individual, not the population, so it seems that he has missed or ignored the issue of what is the object.


(A much more interesting criticism (to me) assumes that in an asexual population two different good mutations of two different genes arise in different individuals. Now their sweeps are competing with each other. It is a random walk as to which will prevail, and then the losing mutation will have to develop again.)


So Spetner's second critique also fails. He makes a fling that Wilf & Ewens have ignored Fisher, and the chance that even a good mutation can get lost, but this is unfair, since the original paper says:




In practice further modifications are needed to the calculations since, because of stochastic events, only a proportion of selectively favored new mutations become fixed in a population.
Spetner has also posted a version of his correspondence with the PNAS Board, to support a contention that his critique was rejected unfairly. It seems to me that the reasons given don't align with the real issues with the critique.


Saturday, May 28, 2011

Signature in the Cell, reviewed by David vun Kannon

I won my copy of Signature in the Cell in an essay contest on the intelligent design advocacy blog, Uncommon Descent. I didn't even pay for shipping.

I made a strong attempt to read it through in order to write a review of the book for UD. Sadly, that blog often bans dissenting voices, so my review will have to be published here instead.

The book is too long for its stated purpose. For its unstated purpose, it is about right. The stated purpose is to review the history of DNA science, and Meyer's own life, as a framework to explain the inadequacy of naturalistic explanations of the genetic code. The unstated purpose is to throw a lot of basic history and science at the reader so that when the science becomes merely 'sciencey' most will not notice the transition. The result is that three small books (DNA for Dummies, My Life, and ID, the Theory That Couldn't) have been woven together and sold as one.

On p. 143, Meyer tells us that "The idea of design helped liberate Western science from such fact-free reasoning." "Such" reasoning belonged to the Greeks that argued from first principles, and purely from logic, to the actual state of the world. Signature in the Cell almost immediately falls back into that error when Meyer argues purely from logic, analogy, and common sense instead of experiment and calculation.

This abandonment of experiment is what most clearly justifies calling the book non-scientific, and even anti-scientific. A good example is Meyer's treatment of Michael Polanyi's arguments on pp 237-243. Meyer is convinced when Polanyi 'argues', 'insists', and 'concludes' all without doing a single experiment. It is the logical structure that is convincing. This is a retreat from science.

Polanyi's argument is central to many claims of ID, so lets talk about it a bit deeper. Polanyi makes the claim that to function as a code, the order of the bases can't be forced by potential energy. ATC and G must be free to come in any order. This is argued by analogy to human communication systems.

However, we already know there are exceptions to such rules. In English, Q must be followed by U. And yet, we somehow stumble forward using English to communicate. Similarly, there may be slight influences in base to base sequence.

Polanyi was writing when almost nothing had been sequenced, today we have thousands of complete genomes to test the idea. But testing the idea is irrelevant if Meyer is already convinced by the logic.

Since Meyer is focused on the genetic code, Polanyi's argument is a major intellectual roadblock. Sequence independence of symbols is far less important than the translation from one symbol system to another, in understanding what a code is and how it functions. DNA is a code for protein (and RNA). Sequence independence means random sequences can acquire meaning slowly and stochastically, not that the entire code was graven on tablets of stone before the world's creation, and then delivered from heaven by a choir of angels.

This process of "acquiring meaning" in the case of the genetic code means narrowing down the association of each triplet of bases from any random amino acid to a specific amino acid. There is a lot of evidence that this process is at least in part driven by the laws of physics and chemistry, contra Polanyi's pronouncements of 40 years ago. But you are not going to learn that from Signature in the Cell.

Meyer also indulges in a 'big number' argument about the size of proteins (and RNA polymers). Starting from an assertion that we need 150 amino acids for functionality, and old and often refuted argument follows that the universe doesn't have the resources to find even one such protein. Sadly no. Meyer ignores all evidence that vastly smaller fragments of protein have useful function.

Function in proteins is often associated not with a specific arrangement of amino acids, but with the polar/non-polar nature of the amino acid. (If you want to think in terms of symbols, this is cutting down the number of symbols from 22 to 2.) While the universe can't explore 22^150 sequences, it certainly can explore 2^15 sequences, then use two of the best 15-length sequences together in a 30-length sequence. Etc, Etc. But Stephen Meyer is not going to tell you that.

Signature in the Cell is padded with a lot of historical information. Dr Meyer can claim that it is included to show that he is giving every argument a fair opportunity. Exactly the opposite is true. In chapter 14, pp 296-297, Meyer recounts an exchange with Dr Kenneth Miller over his coverage of the RNA world in an article from 2000.

The article, DNA and Other Designs, is still available on the Discovery Institute web site. I recommend reading it, since it says just about everything that Meyer says in this large book, and for free. But just as Signature in the Cell recapitulates and expands on that article, it recapitulates the error of that article as well. As Dr Miller complained in 2000, Stephen Meyer lies by omission by "not having the space" to mention 20 years worth of research in the RNA World hypothesis. Now it is 28 years, and the page count of Signature in the Cell spent on long forgotten theories crowds out discussion of current theories and work that directly undercuts the main ideas of the book.

There is no mention of the work of Michael Yarus' lab, no mention of the stereochemical hypothesis in the origin of the genetic code. This is the key work that Meyer has to come to grips with if his whole facade of looking into every possibility is to have any credibility at all.

It might be an acceptible debating technique to dodge your opponents best arguments until the time runs out, but that kind of rope-a-dope argumentation isn't science. That is the bottom line verdict on this book. It is not looking at everything and arguing to the best explanation. It is picking and choosing, retelling lots of old stories, personal stories, and some basic science, while avoiding the experiments and evidence that would challenge ID, and collapse its claim to be the best explanation of anything in the universe larger than Stephen Meyer's paycheck. ID explains that perfectly well.

Friday, May 20, 2011

Metamorphosis, a new Illustra film

Illustra is a film production group that makes high quality films for Christian apologetics such as intelligent design. They've produced several films that adapt the look and feel of science documentaries for the purpose of spreading the Gospel.

Just announced, Illustra's newest effort will focus on Monarch butterflies as iconic species for The Argument Regarding Design (TARD). The Discovery Institute has already begun flogging the video.

Monarch butterflies have long been a creationist favorite, for three reasons. They are beautiful delicate creatures. They migrate absurdly long distances. They have a complete metamorphosis that transforms them from larval caterpillar to adult butterfly.

I'm not going to say anything against the creationists and their sense of wonder at Monarch butterflies. It is a good thing, a trait they share with the rest of humanity. Sadly, I'm sure there is a sect out there that thinks butterflies are the work of Satan, and looking at butterflies might lead to evils like dancing. (An application of the internet meme Rule 34 to the religious tendency to hate.)

How about migration? Currently Monarch butterflies migrate north and south across North America every year, a process that lasts generations! Their winter resting site is a small patch of pine forest in Mexico.

It is a dramatic story, but is it a challenge to evolution? The butterflies are doing something completely natural, following their food sources. Their navigation is based on the chemistry of their brains and antennae, which is determined by their gentics.

At the end of the last Ice Age, Monarch butterflies, or a species that preceded them, must have lived far to the south of Mexico. That inference is simply based on temperature. This species might not have been migratory at all. As the Americas warmed, their range expanded northward through Central America. After a point, though, they can't follow the climate change northward, into the huge new areas of open ecological niches, without migrating back south for the winter.

This could have begun with seasonal migration north and south within a single lifetime. The navigation based on the sun and the circadian clock could develop gradually. (I also don't know the extent of the wintering forest back then, but it could easily have been much larger than it is today.)

The real innovative part of Monarch butterfly migration is its multi-generational aspect. The genes that help navigate the butterfly back south have to be carried by several generations of butterfly for which that specific package of genes does no good whatsoever.

This a great example of what Richard Dawkins called the Extended Phenotype. The bodies of the butterflies (their phenotypes) are just carriers for the selfish genes. What matters is not that the phenotypes make the round trip, but that the genes make the round trip. If a reproducing buttefly suffers a mutation or other variational event on the way north in the springtime, its children might not have the genes to fly back. That variation might expand slightly for the two or three generations of butterflies that live over the summer, but in the fall they die faster than other butterflies (selection on variation) because they are not migrating, not migrating as fast, or in the wrong direction.

So our amazement at Monarch butterfly migration shouldn't lead directly to "Goddidit, therefore Jebus." There are amazing, but completely natural and material, explanations for the behavior. Explanations being elaborated by scientists who don't stop at "Wow", but go on to "How?"

And metamorphosis? Again, for the creationist there is no need to ask how, because Jebus is the Answer.

But for everyone else, metamorphosis is one of the coolest things around!

Lets remember that metamorphosis has been around for a long time. Crustaceans in the ocean do it. It has clear evolutionary value by letting a species exploit two (or more) different niches at different times during the life of an individual.

A very common process during development is the creation of a sheet of cells, and then the destruction of a large group of those cells via a planned cell death (apoptosis). For example, humans have webs between their fingers and toes at a certain point in our embryonic development, and then these webs die back. Cool, but natural - guided by chemical signals guided by genes collected by evolution.

What is happeneing inside the butterfly's coccoon is much the same, though the ratio of surviving and dying cells is very different. Inside the coccoon, most of the cells are dying, giving up their resources and energy to allow other surviving cells reshape the larva into an adult form.

Compared to insects that don't undergo a complete metamorphosis, those that do (like Monarch butterflies) seem to have shifted the timing and extent of hormone releases, a very typical path to speciation known as heterochrony. Heterochrony happens because of variation in gene regulatory networks. Variation with material causes and material effects.

So there is nothing in the history of insects over the last few hundred million years that would suggest that an Intelligent Designer had intervened in the natural processes. It has been said of God that He must love beetles, having made so many of them. But for all that love, he seems to have let all the species of beetle develop the process of metamorphosis just once, in a distant ancestor, and then diversify naturally, almost as if he wasn't involved at all.

It would be great if Illustra's new video intrgated all of this knowledge, and showed how changes from millions of years ago (the origin of insect metamorphosis), climate change (the origin of migration), and ecology united to give us this beautiful, brightly colored animal to share our world with us - and why it was important to preserve the Mexican wintering grounds threatened with deforestation, and provide resting stops along the migration routes stocked with plants that are nutritious to Monarch butterflies. But somehow, I'm afraid the wonder, the sheer wonder is going to dominate.

Monday, May 16, 2011

Rarity vs. Isolation, a problem for Intelligent Design

Douglas Axe is a scientist, and a creationist, judging from his affiliation with Biola University. (Biola requires signing a faith statement.) He has occasionally published studies relating to the occurence of protein folds, using mutation as a way to determine the frequency of functional folds. His overall research program is to show that functional folds are so rare in nature that they could not arrive by chance mutation from an existing fold (killing evolution) or by chance from random polypeptides (killing abiogenesis).

Axe's most recent peer reviewed work is Axe 2004. Of course, anything even mildly supportive of ID in the peer reviewed literature gets a lot play, and this did. It has recently gotten some more, as Doug has blogged about some reactions to it from Steve Matheson and Art Hunt. Here are some of my observations.


Side point 1 - As with Guillermo Gonzales, advocating creationism seems to be negatively correlated with publishing. Gonzales couldn't get tenure because his publishing and grants dried up, and Axe publishes very infrequently.


Side point 2 - Axe's argument is essentially a variation on the argument from improbability - the universe doesn't possess the time/resources required for evolution to work. As such, it is a "bignum" argument, and the most important bignum in the ID memenet is Dembski's Universal Probability Bound. This UPB is usually stated as the odds of something happening have to be greater than 10^-150 before an ID supporter will allow that they might have natural causes. Well, Axe's work is well within that bound. The number usually plucked from Axe is 10^-77 as the "chance" for a functional protein. That is 80 orders of magnitude more likely than UPB, so Axe is really not supporting ID if these folks could keep their bignums straight.


The main point - rarity is not isolation. Even if we grant for the purposes of argument that Axe's rarity number is correct, that doesn't mean proteins, and the genes that make them, are isolated.


Here's an analogy. Gold is rare. But on land, gold is not isolated. If I find a piece of gold in one spot, my expectation (hope) is to find another piece of gold nearby. Lots of people will come and try to find gold nearby. Now there might actually be more gold in the ocean than on land, but if I find one gold atom in a bucket of seawater, I'm not going start my next gold mine where I found that one gold atom.


The difference is the distribution, and isolation is far more about distribution than it is about rarity. Gold on land is very unevenly distributed, rare but not isolated. Gold in seawater is evenly distributed and isolated. At another level, nucleons are extremely rare within the volume of an atom, but not isolated at all. They are all in one lump in the center of the atom.


Of course, there is an underlying process that accounts for this uneven distribution. And if you want to challenge evolution or abiogenesis, you have to challenge the underlying processes, not make hand waving arguments that always assume a uniform distribution. Rarity is not isolation.


Quintessence of Dust: Exploring the protein universe: a response to Doug Axe: "http://disqus.com/forums/quintessenceofdust/exploring_the_protein_universe_a_response_to_doug_axe/trackback/"